View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18873_low_14 (Length: 297)
Name: NF18873_low_14
Description: NF18873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18873_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 28009019 - 28009300
Alignment:
| Q |
1 |
aagatttcagactttactatactttttcagttctcctttatttggtttaacttgctttcannnnnnncccttaaagtgaagaaaagaatgccatgctatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28009019 |
aagatttcagactttactatactttttcagttctcctttatttggtttaacttgctttcatttttttcccttaaagtgaagaaaagaatgccatgctatc |
28009118 |
T |
|
| Q |
101 |
aactttggggacatgttcgtcatagcttaaactacagaacggtttttgattaacacaatttattcattcatcaacgtcaactttgtcaaattttttgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28009119 |
aactttggggacatgttcgtcatagcttaaactacagaacggtttttgattaacacaatttattcattcatcaacgtcaactttgtcaaattttttgata |
28009218 |
T |
|
| Q |
201 |
ttgaattgagttgagtaagacaactgaggcattcttcttggaactagaaacattgattgaagataaattatacgtcattgtt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28009219 |
ttgaattgagttgagtaagacaactgaggcattcttcttggaactaggaacattgattgaagataaattatacgtcattgtt |
28009300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University