View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18873_low_7 (Length: 379)
Name: NF18873_low_7
Description: NF18873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18873_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 158 - 352
Target Start/End: Complemental strand, 8003057 - 8002863
Alignment:
| Q |
158 |
tgatacttgagaaggttggattttgacatgacatattgatatgcacatataattgttgttaaaagcatgcaacatgtcctataaagctcttttggatgca |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003057 |
tgatacttgagaaggttggattttgacatgacatgttgatatgcacatataattgttgttaaaagcatgcaacatgtcctataaagctcttttggatgca |
8002958 |
T |
|
| Q |
258 |
gtacctatgttaaaagctacctttcacatgttcacttttgctttttgagagctaattgattccaagatcaatgaacatgaatggttggacttagg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8002957 |
gtacctatgttaaaagctacctttcacatgttcacttttgctttttgagagctaattgattccaagatcaatgaacatgaatggttggacttagg |
8002863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 8003214 - 8003104
Alignment:
| Q |
1 |
aatttaaaatcttcaaaatcacttttgaaaataggatattgagaggctattagtgatggctatgtgctgctttgacacccatgtgaagctgaattttcat |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003214 |
aatttaaaatcttcaaaatcatttttgaaaataggatattgagaggctattagtgatggctatgtgctgctttgacacccatgtgaagctgaattttcat |
8003115 |
T |
|
| Q |
101 |
gaacccccatc |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
8003114 |
gaacccccatc |
8003104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University