View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18874_high_12 (Length: 308)
Name: NF18874_high_12
Description: NF18874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18874_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 294
Target Start/End: Complemental strand, 11585781 - 11585495
Alignment:
| Q |
16 |
ggttatacccttcttgtgttgtactatattttgatagttttcaagggttgggtgttggttggagggttaggtta---------atgannnnnnnctttgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
11585781 |
ggttatacccttcttgtgttgtactacattttgatagttttcaagggttgggtgttggttggagggttaggttagctcttgaaatgatttttt-ctttgt |
11585683 |
T |
 |
| Q |
107 |
cgggggataccatctttcaagtatatggtggaaatggtgaaattcactttttggaaattattcttgagtaagaaccctagtagcatattcttctcctata |
206 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11585682 |
cgagggataccatctttcaagtatatgatggaaatggtgaaattcactttttggaaattattcttgagtaagaaccctagtagcatatgcttctcctata |
11585583 |
T |
 |
| Q |
207 |
agtgtgaagtgaagcctactatatgctttagccgataggtttcttttgggtgttggagaggggtgtcaatagccttgtcggacctgtt |
294 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
11585582 |
agtgtgaaatgaagcctactatgtgctttagccgataggtttcttttgggtgttggagaggggtgtcgatggccttgtcggacctgtt |
11585495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University