View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18874_high_7 (Length: 410)
Name: NF18874_high_7
Description: NF18874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18874_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 10 - 317
Target Start/End: Original strand, 40329319 - 40329626
Alignment:
| Q |
10 |
cagaacctgtgcaatgaaattgatagaatcaaaaaggagaatgatagcatgcaaattgatctcaggtattatacaaacatttttatttatatgtattgcc |
109 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40329319 |
cagaaccttagcaatgaaattgatagaatcaaaaaggagaatgatagcatgcaaattgatctcaggtattatacaaacatttttatttatatgtattgcc |
40329418 |
T |
 |
| Q |
110 |
ctagctagctataatcaaaatttataaatatcattgatcaagggtacatatatatgttaatttcaggcacttgaagggagaggatattacctcactgaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40329419 |
ctagctagctataatcaaaatttataaatatcattgatcaagggtacatatatatgttaatttcaggcacttgaagggagaggatattacctcactgaat |
40329518 |
T |
 |
| Q |
210 |
tacaaagagctgatggcccttgaggaatcccttgaaaatggtcttactggcgtccgtgacaaaaaggtaattaannnnnnnnaatgtttaatcatagtaa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40329519 |
tacaaagagctgatggcccttgaggaatcccttgaaaatggtcttactggcgtccgtgacaaaaaggtaattaattttttttaatgtttaatcatagtaa |
40329618 |
T |
 |
| Q |
310 |
taactatt |
317 |
Q |
| |
|
|||||||| |
|
|
| T |
40329619 |
taactatt |
40329626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University