View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18874_low_15 (Length: 273)
Name: NF18874_low_15
Description: NF18874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18874_low_15 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 61 - 273
Target Start/End: Original strand, 2392114 - 2392325
Alignment:
| Q |
61 |
accattcaattcccatgnnnnnnnnttgaatttggtcaatagataaataaattctagccaaaatttgttttaactagaatttgaactcgaattttttcgt |
160 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2392114 |
accattcaattcccatgaaaaaaaattgaatttggtcaatagataaataaattctagccaaaatttgttttaactagaatttgaactcgaatttt-tcgt |
2392212 |
T |
 |
| Q |
161 |
cttttatcgtagttcattaactaactatttaaagttaatcatgtgattaatattactagctacccatgattctcaaagaaaagagttgtgatcatccaaa |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2392213 |
cttttatcgtagttcattaactaactatttaaagttaatcatgtgattaatattgctagcgatccatgattctcaaagaaaagagttgtgatcattcaaa |
2392312 |
T |
 |
| Q |
261 |
attcgatcaccat |
273 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2392313 |
attcgatcaccat |
2392325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University