View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18874_low_20 (Length: 236)
Name: NF18874_low_20
Description: NF18874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18874_low_20 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 32148282 - 32148502
Alignment:
| Q |
16 |
ggattgataaaatatcttcagccagttcaccgctcatggcgctctgggtaacgctattccccggggcaacaccgcaggtgttattgttgcagccaggttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
32148282 |
ggattgataaaatatcttcagccagttcaccgctcatggcgctctgggtaacgctattccctggggcaacactgcaggtgttgttgttgcagccaggttt |
32148381 |
T |
|
| Q |
116 |
tggtgatgagaaacaaacaccacagtcgtcggatttggcaagggagcattgggcagagcgacaccgtgcagggcggtatgtggaggaaatgtactggttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32148382 |
tggtgatgagaaacaaacaccacagtcgtcgaatttggcaagggagcattgggcagagcgacaccgtgcaggacggtatgtggaggaaatgtactggttt |
32148481 |
T |
|
| Q |
216 |
tcgcaatcaacccagagaaac |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32148482 |
tcgcaatcaacccagagaaac |
32148502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 32138892 - 32139112
Alignment:
| Q |
16 |
ggattgataaaatatcttcagccagttcaccgctcatggcgctctgggtaacgctattccccggggcaacaccgcaggtgttattgttgcagccaggttt |
115 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||| | ||||||| |||||| |||||| ||||| || ||||| ||||||||||||||||| |
|
|
| T |
32138892 |
ggattgataaaacatcttcagcaagttcaccgctggtggcggtgtgggtaatgctattgtccggggtgacaccacaagtgttgttgttgcagccaggttt |
32138991 |
T |
|
| Q |
116 |
tggtgatgagaaacaaacaccacagtcgtcggatttggcaagggagcattgggcagagcgacaccgtgcagggcggtatgtggaggaaatgtactggttt |
215 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||| || ||||||||||||||||| || || || |||||||||||||||||||| |||||||| | |||| |
|
|
| T |
32138992 |
tggtgatgagaaacaatcaccacagccgtcggaatttgcaagggagcattgggctgaacggcagcgtgcagggcggtatgtggaagaaatgtatttgttt |
32139091 |
T |
|
| Q |
216 |
tcgcaatcaacccagagaaac |
236 |
Q |
| |
|
||||| |||||||| |||||| |
|
|
| T |
32139092 |
tcgcagtcaacccaaagaaac |
32139112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 99 - 235
Target Start/End: Original strand, 32127189 - 32127325
Alignment:
| Q |
99 |
ttgttgcagccaggttttggtgatgagaaacaaacaccacagtcgtcggatttggcaagggagcattgggcagagcgacaccgtgcagggcggtatgtgg |
198 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||| || |||||||| |||||||||||||| ||| | |||||| ||||||||||||||| |
|
|
| T |
32127189 |
ttgttgcagccgggttttggtgatgagaaacaatcaccacagctatcagatttggcgagggagcattgggcggaggggcaccgtacagggcggtatgtgg |
32127288 |
T |
|
| Q |
199 |
aggaaatgtactggttttcgcaatcaacccagagaaa |
235 |
Q |
| |
|
||||| |||| |||||||| || || ||||||||||| |
|
|
| T |
32127289 |
aggaagtgtagtggttttcacagtcgacccagagaaa |
32127325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University