View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18875_high_19 (Length: 212)
Name: NF18875_high_19
Description: NF18875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18875_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 8 - 196
Target Start/End: Complemental strand, 6248981 - 6248793
Alignment:
| Q |
8 |
catcatcatcactatctgattgtgaaattatctcccattcgatgtcgaaaatttgatggtggctaggcctagttgatccggtcatcttaatttgttggtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6248981 |
catcatcatcactatctgattgtgaaattatctcccattcgatgtcgaaaatttgatggtggctaggcctagttgttccggtcatcttagtttgttggtg |
6248882 |
T |
 |
| Q |
108 |
ggaaatcactttgtctttgatgtcgtaggtttgaggtcgatagtgttnnnnnnncgagcaaatataagtctgagtgctatgttttttgt |
196 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6248881 |
gaaaatcactttgtctttgatgtcgtaggtttgaggtcgatagtgttaaaaaaacgagcaaatataagtctgagtgctatgttgtttgt |
6248793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University