View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18875_low_12 (Length: 275)
Name: NF18875_low_12
Description: NF18875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18875_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 257
Target Start/End: Complemental strand, 30437952 - 30437700
Alignment:
| Q |
8 |
gagcacagaggaagaattatgttatctgaattcaaagtagctgtgaagtttgtttagctttgttgtttcgattccttttcttgtttggcagcctgcaaat |
107 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30437952 |
gagctcagaggaagaattttgttatctgaattcaaagtagctgttaagtttgtttagctttgttgtttcgattccttttcttgtttggcagcctgcaaat |
30437853 |
T |
 |
| Q |
108 |
actaatttcattgcaaacaaataatacatagattttatcatagatattagatattgataacaaagagttgtgactcctctgcttcatttaatttgcaaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30437852 |
actaatttcattgcaaacaaataatacatagattttatcatagatattagatattgataacaaagagttgtgactcctctgcttcatttaatttgcaaaa |
30437753 |
T |
 |
| Q |
208 |
ttctctacac---ctgcaattttgtatgctttgtgaaatatgagagctgaacc |
257 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30437752 |
ttctctacaccttctgcaattttgtatgctttgtgaaatatgagagctgaacc |
30437700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 83 - 254
Target Start/End: Original strand, 18471993 - 18472157
Alignment:
| Q |
83 |
ttttcttgtttggcagcctgcaaatactaatttcattgcaaacaaataatacatagattttatcatagatattagatattgataacaaagagttgtgact |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||| ||| | |||||||| |||||||| |||||| |
|
|
| T |
18471993 |
ttttcttgtttggcagcctgcaaatactaattgcattgcaaacaaataatataaagattttgtca-------tggatattgagaacaaagaattgtga-- |
18472083 |
T |
 |
| Q |
183 |
cctctgcttcatttaatttgc-aaaattctctacac---ctgcaattttgtatgctttgtgaaatatgagagctga |
254 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| ||| |||| | |||||||||||||||||||||| ||||||| |
|
|
| T |
18472084 |
-ctctgcttcatttaatttgcgaaaatgctccccacattctgc-actttgtatgctttgtgaaatatgtgagctga |
18472157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University