View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18876_high_3 (Length: 324)
Name: NF18876_high_3
Description: NF18876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18876_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 1899988 - 1900293
Alignment:
| Q |
1 |
atattcatagctgattgaattgtgtgaatgaaatgaagtgtttttcctatttcaaatataaacacaaaggtaggggtcaaagatcagcacctgagctaga |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1899988 |
atattcataggtgattgaattgtgtgaatgaaatgaagtgtttttcctatttcaaatataaacacaaaggtaggggtcaaagatcagcacctgagctaga |
1900087 |
T |
 |
| Q |
101 |
agagcaagagaaacatcagttttcaggatctgaaagagttaccaagtcttcttgttcatctagctcttctcctaggggtataccaaaactttatgaggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1900088 |
agagcaagagaaacatcagttttcaggatctgaaagagttacaaagtcttcttgttcatctacctcttcacctaggggtataccaaaactttatgaggag |
1900187 |
T |
 |
| Q |
201 |
aagggtcataatttgagggttttttctttctcagaactcagccgtgcgacaagtgacttcaataggcttcttaagataggagaaggtgggtttggaagtg |
300 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1900188 |
aagggccataatttgagggttttttctttctcagagctcagccgtgcgacgagtgacttcaataggcttcttaagataggagaaggtggttttggaagtg |
1900287 |
T |
 |
| Q |
301 |
tattta |
306 |
Q |
| |
|
|||||| |
|
|
| T |
1900288 |
tattta |
1900293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University