View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18878_high_15 (Length: 269)
Name: NF18878_high_15
Description: NF18878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18878_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 50 - 255
Target Start/End: Original strand, 9866149 - 9866350
Alignment:
| Q |
50 |
aagccaagtattactcatgcttttttggtacattattattactcatgcttgttaagactgatgtcggttggttataaaaattatattaaacctacaatat |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9866149 |
aagccaagtattactcatgcttttttggtacattatta---ctcatgcttgttaagactgatgtcggttggtta-aaaaattatattaaacctacaatat |
9866244 |
T |
 |
| Q |
150 |
ttttcacataattatcattattattttgctataaatgtatatgttcttctagtcaccttacaaacattaattatggaaacccttaaattcattatgtgcc |
249 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9866245 |
ttttcacataaatatcattatcattttgctataaatgtatatgttcttctagtcaccttacaaacattaattatggaaacccttaaattcattatgtgcc |
9866344 |
T |
 |
| Q |
250 |
ccttat |
255 |
Q |
| |
|
|||||| |
|
|
| T |
9866345 |
ccttat |
9866350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University