View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18878_high_16 (Length: 248)
Name: NF18878_high_16
Description: NF18878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18878_high_16 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 155 - 248
Target Start/End: Original strand, 43541197 - 43541289
Alignment:
| Q |
155 |
ttgcggttagttagcaatacctttatgcttgtaattcaaaggaatgagattgaaatgataatgttgcattgtttggttttttaacttaggaaac |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43541197 |
ttgcggttagttagcaatacctttatgcttgtaattcaaag-aatgagattgaaatgataatgttgcattgtttggttttttaacttaggaaac |
43541289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University