View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18878_high_17 (Length: 246)
Name: NF18878_high_17
Description: NF18878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18878_high_17 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 17301355 - 17301585
Alignment:
| Q |
16 |
aaaactcaacgtcagtccctcagttaagtcactcaatgggttgctcacagcttcaatcattatagataatcctaacgaggtaacacaaatttacaaatat |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||||||| | |||||||| | |||||||||| |||||||||| || |
|
|
| T |
17301355 |
aaaactcaacgtcactccctcagttaagtcgctcaatgggttgctcacagctgcaatcattacatataatcctcatgaggtaacacgaatttacaaagat |
17301454 |
T |
|
| Q |
116 |
ttcccgaaaatttactctattaaacctaatgttgatacttataacttggttatgggttattttgttgatactggctcaaccacttctattttctctattt |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17301455 |
ttcccgaaaatgtactctattaaacctaatgctgatacttataacttggttatgggttattttgttgatactggctcaaccacttctattttctctattt |
17301554 |
T |
|
| Q |
216 |
ttgttgatatgagtgtctatcgtgtcaaacc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17301555 |
ttgttgatatgagtgtctatcgtgtcaaacc |
17301585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University