View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18878_low_18 (Length: 241)
Name: NF18878_low_18
Description: NF18878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18878_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 34 - 227
Target Start/End: Original strand, 35322719 - 35322912
Alignment:
| Q |
34 |
ttttaaggaaaataatattgttgagttgtatactttcatcatgttaatacatatatcacacagttaattaattgattgaaataataaagcttgcatataa |
133 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35322719 |
ttttaaagaaaataatattgttgagttgtatactttcatcatgttaatacatatatcacacagttaattaattgattgaaataataaagcttgcatataa |
35322818 |
T |
|
| Q |
134 |
attttttgacttgagattttgaagtgtactctcaaaatttttgatgtcaatttcgtcatgttagtttgatttcttctataattaagatagatgt |
227 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35322819 |
attttttgacttcaaattttgaagtgtactctcaagatttttgatgtcaatttcgtcatgttagtttgatttcttctataactaagatagatgt |
35322912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University