View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18879_high_7 (Length: 265)
Name: NF18879_high_7
Description: NF18879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18879_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 30805432 - 30805189
Alignment:
| Q |
1 |
taataacattatcataccaattccacagaacagcatgcattgcagttctatccttagcagcatccttttctgcaaaaagcgccactaccctttcatcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805432 |
taataacattatcataccaattccacagaacagcatgcattgcagttctatccttagcagcatccttttctgcaaaaagcgccactaccctttcatcaga |
30805333 |
T |
 |
| Q |
101 |
cacaagctcagcaaccactttagccctcactttactcccttctccactgcctccgagcaccctactcgccaccctcaccgcggcaccagcactaacatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805332 |
cacaagctcagcaaccactttagccctcactttactcccttctccactgcctccgagcaccctactcgccaccctcaccgcggcaccagcactaacatga |
30805233 |
T |
 |
| Q |
201 |
cacctacctaacagccctaaaaacacccctttcgccgtctccgc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805232 |
cacctacctaacagccctaaaaacacccctttcgccgtctccgc |
30805189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 30806868 - 30806812
Alignment:
| Q |
1 |
taataacattatcataccaattccacagaacagcatgcattgcagttctatccttag |
57 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
30806868 |
taataacattatcataccaattccaaagaacagcatgcattgctgttctatccttag |
30806812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University