View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18880_low_10 (Length: 230)
Name: NF18880_low_10
Description: NF18880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18880_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 11887724 - 11887521
Alignment:
| Q |
18 |
agaaacttatctcttttatgcacgttggatttggacatattttagtgtatctatatacatatactacagtaatttgtagtgtaagtttgactcgattttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11887724 |
agaaacttatctcttttatgcacgttggatttgc-catattttaatgtatctatatacatatactatagtaatttgtagtgtaagtttgactcgattttg |
11887626 |
T |
 |
| Q |
118 |
gtgttctaacttttctcacgttgcacttgcgcattgttttacgctttctctaacgtcc--nnnnnnnnctccttccaaatccaatcgtttgctccctttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11887625 |
gtgttctaacttttctcacgttgcacttgcgcattgttttacgctttctctaacgtcctattttttttctccttccaaatccaatcgtttgctccctttg |
11887526 |
T |
 |
| Q |
216 |
cttct |
220 |
Q |
| |
|
|||| |
|
|
| T |
11887525 |
tttct |
11887521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University