View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18880_low_8 (Length: 245)
Name: NF18880_low_8
Description: NF18880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18880_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 229
Target Start/End: Original strand, 21509512 - 21509730
Alignment:
| Q |
11 |
caaaggcattgcatttcataagtaaagctatcaagggtgattataatctcaatgacttcagtcttaatgaaaaaacaggattttctaaaaattctgttga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21509512 |
caaaggcattgcatttcataagtaaagcaatcaagggtgattataatctcaatgacttcagtcttaatgaaaaaacaggattttctaaaaattctgttga |
21509611 |
T |
|
| Q |
111 |
acagaaagaaaatagttttcaggaagatgttaaatttcatgaaagaattactaggaaaaatggagcggtgaagcctccctcgcccatgcgagacccgcgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21509612 |
acagaaagaaaatagttttcaggaagatgttaaatttcatgaaagaattactaggaaaaatggagcagtgaagcctccctcgcccatgcgagacccgcgt |
21509711 |
T |
|
| Q |
211 |
catccatcacctaaggtat |
229 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
21509712 |
catccatcacctaaggtat |
21509730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University