View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18880_low_9 (Length: 244)

Name: NF18880_low_9
Description: NF18880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18880_low_9
NF18880_low_9
[»] chr5 (1 HSPs)
chr5 (1-218)||(2223214-2223431)


Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 2223214 - 2223431
Alignment:
1 gagggtaggaggaatcatggattggattggtgtgaagctatgtgttcttgttttatgaaaatggatagtgaaattggagtcggtggaagttgtggtgatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
2223214 gagggtaggaggaatcatggattggattggtgtgaagctatgtgttcttgttttatgaagatggatagtgaaattggagtcggtggaagttgtggtgatg 2223313  T
101 aggttgatgggaataccgtgggttcgacggcggctgtggtggtggtggggaaggaggagattgtagtggcgaattgtggtgactcaagggcggtgctttg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2223314 aggttgatgggaataccgtgggttcgacggcggctgtggtggtggtggggaaggaggagattgtagtggcgaattgtggtgactcaagggcggtgctttg 2223413  T
201 tagtggcggtgtagcggt 218  Q
    ||||||||||||||||||    
2223414 tagtggcggtgtagcggt 2223431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University