View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18881_low_1 (Length: 271)
Name: NF18881_low_1
Description: NF18881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18881_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 137 - 254
Target Start/End: Original strand, 32452065 - 32452182
Alignment:
| Q |
137 |
tgatttttccttgtgacaaatagctttatcgattataaacttggaatatggtgttcacttattggttattttgaacttctactatagtttgcacttgttg |
236 |
Q |
| |
|
|||||||||||| ||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
32452065 |
tgatttttccttatgacaaataacttgatcgattataaacttgaaatatggtgttcacttattggttattttgaacttctactatagtatgcacttattg |
32452164 |
T |
 |
| Q |
237 |
gttatgctataggttatt |
254 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32452165 |
gttatgctataggttatt |
32452182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University