View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18881_low_2 (Length: 237)
Name: NF18881_low_2
Description: NF18881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18881_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 8886843 - 8886634
Alignment:
| Q |
18 |
ctttgtcttcactgctcttactttgaagaaaccttacttcattgcacatgatactgcacaacctccaccaacctctggcatgctatgggcttcagctctg |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
8886843 |
ctttgtcctcactgctcttactttgaagaaaccttacttcattgcacatgatactgcacaacctccaccaacctctggcatgctctgggcttcagctttg |
8886744 |
T |
|
| Q |
118 |
ttgagtttttctctaacacagatgctttgtgttggcttaggcaaagactcacctcccaatcttccaatatcttcgccgtaggagtgtggtggttttggag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8886743 |
ttgagtttttctctaacacagatgctttgtgttggcttaggcaaggactcacctcccaatcttccaatatcttcgccgtaggagtgtggtggtcttggag |
8886644 |
T |
|
| Q |
218 |
aaatcaaaat |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
8886643 |
aaatcaaaat |
8886634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 156
Target Start/End: Original strand, 27583563 - 27583623
Alignment:
| Q |
96 |
catgctatgggcttcagctctgttgagtttttctctaacacagatgctttgtgttggctta |
156 |
Q |
| |
|
|||||| ||||||||| || | |||||||||||||||| ||| ||||||| ||||||||| |
|
|
| T |
27583563 |
catgctttgggcttcatctttattgagtttttctctaatccaggtgctttgagttggctta |
27583623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University