View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18882_high_3 (Length: 260)
Name: NF18882_high_3
Description: NF18882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18882_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 242
Target Start/End: Original strand, 40442094 - 40442325
Alignment:
| Q |
11 |
gattatactgatgcatctttacttgcgtacaaattttcttcacaaaattttaatgagtatacaaattttcaagcacacggagtatgatagaaactaaaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40442094 |
gattatactgatgcatctttacttgcgtacaaattttcttcacaaaattttaatgagtatacaaattttcaagcacacggagtatgatagaaactaaaag |
40442193 |
T |
|
| Q |
111 |
tggaatccacttgtcttaactcttatccctggaatctgtaggtacaacacaaccacacaatcttttaccaacttgatcaatattttggacatccttgaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40442194 |
tggaatccacttgtcttaactcttatccctggaatctgtaggcacaacacaaccacacaatcttttaccaacttgatcaatattttggacatccttgtga |
40442293 |
T |
|
| Q |
211 |
ttgaggcactgattacttttctatgtccatac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40442294 |
ttgaggcactgattacttttctatgtccatac |
40442325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 18812887 - 18812934
Alignment:
| Q |
11 |
gattatactgatgcatctttacttgcgtacaaattttcttcacaaaat |
58 |
Q |
| |
|
||||||| ||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
18812887 |
gattatattgatgcacctttacttacatacaaattttcttcacaaaat |
18812934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University