View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18882_low_4 (Length: 231)
Name: NF18882_low_4
Description: NF18882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18882_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 40 - 213
Target Start/End: Complemental strand, 37219697 - 37219518
Alignment:
| Q |
40 |
aattagaaatacactcgatttttctttttaatagaccatactaactcattgaaattgtcacttgaaaagatggaacatc-gacgttaagaaaaacatgtc |
138 |
Q |
| |
|
||||||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||| | |
|
|
| T |
37219697 |
aattagatatacactggattttt-tttttaatagaccatactaactcattgaaattgtcactcgagaagatggaacatcagacgttaagaaaaacatgcc |
37219599 |
T |
|
| Q |
139 |
attcaaatcaacaccataccaactga-------ttacaaacactcgcatgttaagtaagttcacaaggatttatagaaatac |
213 |
Q |
| |
|
||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37219598 |
attcaaatcaacacc-taccacctgaagtgggtttacaaacactcgcatgttaagtaagttcacaaggatttatagaaatac |
37219518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 12 - 46
Target Start/End: Complemental strand, 37219754 - 37219720
Alignment:
| Q |
12 |
attatactagacaatattcataaaataaaattaga |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37219754 |
attatactagacaatattcataaaataaaattaga |
37219720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University