View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18882_low_4 (Length: 231)

Name: NF18882_low_4
Description: NF18882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18882_low_4
NF18882_low_4
[»] chr2 (2 HSPs)
chr2 (40-213)||(37219518-37219697)
chr2 (12-46)||(37219720-37219754)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 40 - 213
Target Start/End: Complemental strand, 37219697 - 37219518
Alignment:
40 aattagaaatacactcgatttttctttttaatagaccatactaactcattgaaattgtcacttgaaaagatggaacatc-gacgttaagaaaaacatgtc 138  Q
    ||||||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||| |    
37219697 aattagatatacactggattttt-tttttaatagaccatactaactcattgaaattgtcactcgagaagatggaacatcagacgttaagaaaaacatgcc 37219599  T
139 attcaaatcaacaccataccaactga-------ttacaaacactcgcatgttaagtaagttcacaaggatttatagaaatac 213  Q
    ||||||||||||||| ||||| ||||       |||||||||||||||||||||||||||||||||||||||||||||||||    
37219598 attcaaatcaacacc-taccacctgaagtgggtttacaaacactcgcatgttaagtaagttcacaaggatttatagaaatac 37219518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 12 - 46
Target Start/End: Complemental strand, 37219754 - 37219720
Alignment:
12 attatactagacaatattcataaaataaaattaga 46  Q
    |||||||||||||||||||||||||||||||||||    
37219754 attatactagacaatattcataaaataaaattaga 37219720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University