View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18883_low_1 (Length: 300)
Name: NF18883_low_1
Description: NF18883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18883_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 170 - 285
Target Start/End: Complemental strand, 9678327 - 9678212
Alignment:
| Q |
170 |
tgagtgtgggggtgatgattgaagctttttacatttatgctttggttatggcctatgatgggaaatgctatgatgtacatgaggtggcatatggagtagt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9678327 |
tgagtgtgggggtgatgattgaagctttttacatttatgctttggttatggcctatgatgggaaatgctatgatgtgcatgaggtggcatatggagtagt |
9678228 |
T |
|
| Q |
270 |
gttgaaccaatctttt |
285 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9678227 |
gttgaaccaatctttt |
9678212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 47 - 150
Target Start/End: Complemental strand, 9678456 - 9678353
Alignment:
| Q |
47 |
tagtgatatggttccataactcttgtacttgaagttcttcaacctatttgttttcttcttcttctggttgtgacaaagagagtaaagtgaggaatttaaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9678456 |
tagtgatatggttccataactcttgtacttgaagttcttcaacctatttgttttcttcttcttctggttgtgacaaagagagtaaagtgaggaatttaaa |
9678357 |
T |
|
| Q |
147 |
ggtg |
150 |
Q |
| |
|
|||| |
|
|
| T |
9678356 |
ggtg |
9678353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 16 - 50
Target Start/End: Complemental strand, 9678517 - 9678483
Alignment:
| Q |
16 |
atgaaagcttacatcatatgaatcaaaatagtagt |
50 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
9678517 |
atgaaagcttacatcatatgaatccaaatagtagt |
9678483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University