View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18884_low_12 (Length: 342)
Name: NF18884_low_12
Description: NF18884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18884_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 334
Target Start/End: Complemental strand, 47199978 - 47199645
Alignment:
| Q |
1 |
ttttcctttttgtttattgattttatgaaggactggtgaaacttgttgaagaaactgttaaacaagagcaagctctatccccaaagaagccaatttatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47199978 |
ttttcctttttgtttattgattttatgaaggactggtgaaacttgttgaagaagctgttaaacaagagcaagctctatccccaaagaagccaatttatat |
47199879 |
T |
|
| Q |
101 |
cgtcggcgattccttaggtggatgccttgcacttgctgttgccgctcgtaatccaacggttgatctagtacttattttagtcaatcctggtgagtctatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47199878 |
cgtcggcgattccttaggtggatgccttgcacttgctgttgccgctcgtaatccaacggttgatctagtacttattttagtcaatcctggtgagtctatc |
47199779 |
T |
|
| Q |
201 |
agtgttgtattcctttctgtcaaatttgttcgcattttattgggtaatgatttgtcaatgccgtagcatgataataattctgttacctttcaaccacagc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47199778 |
agtgttgtattcctttctgtcaaatttgttcgcattttattgggtaatgatttgtcaatgccgtagcatgataataattctgttacctttcaaccacagc |
47199679 |
T |
|
| Q |
301 |
tacatcctttggtagatctcagttgcaacctttg |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47199678 |
tacatcctttggtagatctcagttgcaacctttg |
47199645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University