View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18884_low_21 (Length: 230)
Name: NF18884_low_21
Description: NF18884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18884_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 115 - 212
Target Start/End: Original strand, 54120667 - 54120764
Alignment:
| Q |
115 |
acaaatcaggtcttaactttggacttaggtttataccgtaactctccatctaatagtaaataaaatctagggcgtatcatatcttatcagctaaatat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
54120667 |
acaaatcaggtcttaactttggacttaggtttataccgtaactctccatctaatagtaaataaaatttagggcgtatcatatcttatcagttaaatat |
54120764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 54120626 - 54120676
Alignment:
| Q |
18 |
aatttatgtttggttatggttatgtctatgtgttttgaggaacaaatcagg |
68 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54120626 |
aatttatgcttggtaatggttatgtctatgtgttttgaggaacaaatcagg |
54120676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University