View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18884_low_22 (Length: 227)
Name: NF18884_low_22
Description: NF18884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18884_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 19 - 138
Target Start/End: Original strand, 7495803 - 7495922
Alignment:
| Q |
19 |
gaaaaccacaaaatgtatatctctttgctcttagtttttactgaagtttatacaaaatttatttctctatgtgcattatcattaccatattcaatttctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
7495803 |
gaaaaccacaaaatgtatatctctttgctcttagtttttactgaagtttatacaaaatttatttctctatgtgcattatcatcacgatattcaatttctt |
7495902 |
T |
 |
| Q |
119 |
gctatatactactagtattg |
138 |
Q |
| |
|
||| | |||||||||||||| |
|
|
| T |
7495903 |
gctgtgtactactagtattg |
7495922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 53 - 123
Target Start/End: Original strand, 7505748 - 7505818
Alignment:
| Q |
53 |
tttttactgaagtttatacaaaatttatttctctatgtgcattatcattaccatattcaatttcttgctat |
123 |
Q |
| |
|
|||| ||||| |||| || ||||||||||||||| ||| ||||| ||| ||||| |||||||||||||||| |
|
|
| T |
7505748 |
ttttaactgatgtttgtagaaaatttatttctctctgtccattaccatcaccatgttcaatttcttgctat |
7505818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University