View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18885_low_5 (Length: 307)
Name: NF18885_low_5
Description: NF18885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18885_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 17 - 158
Target Start/End: Complemental strand, 27752540 - 27752399
Alignment:
| Q |
17 |
gtttctccttcttcctctcatcctcgtcttcttcgtttctcccccaaagcaactcattcctcctccaacaacgatttctttgagttcttcccttggtccg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27752540 |
gtttctccttcttcctctcatcctcgtcttcttcgtttctcccccaaagcaactcattcctcctccaacaacgatttcttcgagttcttcccttggtccg |
27752441 |
T |
 |
| Q |
117 |
acgacgataacggttcgctcttcaatttcatattccagctga |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27752440 |
acgacgataacggttcgctcttcaatttcatattccagctga |
27752399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 191 - 260
Target Start/End: Complemental strand, 27752366 - 27752297
Alignment:
| Q |
191 |
gtgtaccacacgttaaattcaaagattagggatctttaatcagaaagtctgaattttaaggaaattgtgt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27752366 |
gtgtaccacacgttaaattcaaagattagggatctttaatcagaaagtctgaattttaaggaaattgtgt |
27752297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University