View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18886_high_12 (Length: 298)
Name: NF18886_high_12
Description: NF18886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18886_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 6 - 291
Target Start/End: Complemental strand, 36344660 - 36344385
Alignment:
| Q |
6 |
attttattcaatggaataatcactatgtgcgagctgaccatgagaaatatggcaaaatcgagctatttctaacaaaagttgatttaatatgagctacttg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || | |||| || ||| || ||| |
|
|
| T |
36344660 |
attttattcaatggaataatcactatgtgcgagctgaacatgagaaatatggcaaaatcgagctacttg-atttaaagatg--tta-------ctcgttg |
36344571 |
T |
 |
| Q |
106 |
attagttaccttttgttgcatagttatagattttccttacttacttcgacccaagtttaccatccatatcccaaacaacgcaataggaagggaaattcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36344570 |
attagttaccttttgttgcatagttatagattttccttacttgcttcgacccaagtttaccatccatatcccaaacaacgcaataggaagggaaattcat |
36344471 |
T |
 |
| Q |
206 |
tgtgtagtgggtagaatttggcctattcgtaggttctgccccatcaatccatgtggcacatgacatgtcacctatatccatcaaat |
291 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36344470 |
tgtgcagtgggtagaatttggtctattcgtaggttctgccccatcaatccatgtggcacatgacatgtcacctatatccatcaaat |
36344385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University