View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18886_high_18 (Length: 261)
Name: NF18886_high_18
Description: NF18886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18886_high_18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 34101388 - 34101629
Alignment:
| Q |
20 |
atgaagaagatgaaaaactacttccacgtgtacacgatttccaaacttaacgattttgcgaaaccgttacttcaagcacagattcctcacaatctccata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||| | |
|
|
| T |
34101388 |
atgaagaagatgaaaaactacttccacgtgtacacgatttccaaacttgacgattttgcgaaatcgttacttcaagcacagattccttacaatctccaca |
34101487 |
T |
 |
| Q |
120 |
ttgtgatggatcatgaaatcaaggagcgtctctgcttagagatcaacactctcaacctcagcgcgcttatcgttggaagggggcgagtattgcgttcgcc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34101488 |
ttgtgatggatcatgaaatcaaggagcgtctctgcttagagatcaacagtctcaacctcagcgcgcttatcgttggaagggggcgagtattgcgttcgcc |
34101587 |
T |
 |
| Q |
220 |
attgcaaatgtcctgttgttgttgttggaagttctgatgaaa |
261 |
Q |
| |
|
||||| |||||||||||| |||||| |||||||||||||||| |
|
|
| T |
34101588 |
attgcgaatgtcctgttggtgttgtgggaagttctgatgaaa |
34101629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University