View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18886_high_22 (Length: 256)
Name: NF18886_high_22
Description: NF18886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18886_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 30870139 - 30870319
Alignment:
| Q |
20 |
gtgtaagcgtggccaagtgtggtatgtatggacccttacaaccagttgtgtgagagtaatcccaatgtataacttaatgggtttggttgacaaaagaaat |
119 |
Q |
| |
|
|||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30870139 |
gtgtaagcgtggacaagtgtggtacgcatggacccttacaaccagttgtgtgagagtaatcccaatgtataacttaatgggtttggttgacaaaagaaat |
30870238 |
T |
|
| Q |
120 |
atccattaggttaagaggttaatgctattaaacgatacacttcgaaggattagagggcactcttgacctaaagaatgtatt |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
30870239 |
atccattaggttaagaggttaattctattaaacgatacacttcgaaggattagagggcattcttgacctaaacaatctatt |
30870319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University