View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18886_high_3 (Length: 463)
Name: NF18886_high_3
Description: NF18886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18886_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 5e-57; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 5e-57
Query Start/End: Original strand, 106 - 249
Target Start/End: Complemental strand, 4096183 - 4096042
Alignment:
| Q |
106 |
ttgaaaagataaatgtttgagcaacatatggaaataggaaatacaaaccttttactttgttgaccaaccatttggttccgccttcaatactgttggacag |
205 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4096183 |
ttgaaaagatagatgtttgagcaacatatggaaataggaaatagaaaccttttactttgttgaccaaccatttggttccgccttcaatactgttggacag |
4096084 |
T |
 |
| Q |
206 |
tgactgcatatcaaaagaaaagaagaaggtgtcaataaagacat |
249 |
Q |
| |
|
|||||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
4096083 |
tgactgcata--atatcaaaagaagaaggtgtcaataaagacat |
4096042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 4 - 83
Target Start/End: Complemental strand, 4097340 - 4097261
Alignment:
| Q |
4 |
ggtagattatactcctttaacaactctggtaatggcttctgcatttttcctgcaaagtgatataattaagttcccttcaa |
83 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4097340 |
ggtagatcatactcctttaacaactctggtaatggcttctgcatttttcctgcaaagtgatataattaagttcccttcaa |
4097261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 351 - 418
Target Start/End: Complemental strand, 4095774 - 4095708
Alignment:
| Q |
351 |
ataaatgttcctctaaagtacaagtttacggtcctactcgtcattatgtctaagatggtgacctaatt |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4095774 |
ataaatgttcctctaaagtacaagtttacg-tcctactcgtcattatgtctaagatggtgacctaatt |
4095708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 419 - 461
Target Start/End: Complemental strand, 4095652 - 4095610
Alignment:
| Q |
419 |
acatattcatttttccttgcttttattgaactggtaccgatca |
461 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4095652 |
acatattcatttttccttgcttttattgaactggtaccgatca |
4095610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 25797168 - 25797235
Alignment:
| Q |
143 |
gaaatacaaaccttttactttgttgaccaaccatttggttccgccttcaatactgttggacagtgact |
210 |
Q |
| |
|
||||||||||||||||| ||||||||| | |||||||||||| |||||||| ||| | |||||||||| |
|
|
| T |
25797168 |
gaaatacaaaccttttaatttgttgacgagccatttggttcctccttcaatgctgcttgacagtgact |
25797235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University