View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18886_low_10 (Length: 386)
Name: NF18886_low_10
Description: NF18886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18886_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 207 - 287
Target Start/End: Original strand, 7368628 - 7368708
Alignment:
| Q |
207 |
gttctttaataactagagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgtttctttaa |
287 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7368628 |
gttctttaataactatagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgtttctttaa |
7368708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 24 - 91
Target Start/End: Original strand, 7368448 - 7368515
Alignment:
| Q |
24 |
atttgtcactaggacttcattccaattgctacaacgatccataaccggtaacaattcaatatggtgca |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7368448 |
atttgtcactaggacttcattccaattgctacaacgatgcataaccggtaacaattcaatatggtgca |
7368515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 3e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 207 - 287
Target Start/End: Original strand, 45632306 - 45632386
Alignment:
| Q |
207 |
gttctttaataactagagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgtttctttaa |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45632306 |
gttctttaataactagagtgaccgtggcagttaaagtgtcgccggtttgacattatgggctttttccctttgtttctttaa |
45632386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 25 - 91
Target Start/End: Original strand, 45632126 - 45632192
Alignment:
| Q |
25 |
tttgtcactaggacttcattccaattgctacaacgatccataaccggtaacaattcaatatggtgca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45632126 |
tttgtcactaggacttcattccagttgctacaacgatccataaccggtaacaattcaatatggtgca |
45632192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 71; Significance: 5e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 207 - 285
Target Start/End: Complemental strand, 53159669 - 53159591
Alignment:
| Q |
207 |
gttctttaataactagagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgtttcttt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53159669 |
gttctttaataactagagtgaccgtggcagttaaagtgtcgccggtttgacattatgggctttttccctttgtttcttt |
53159591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 52 - 91
Target Start/End: Complemental strand, 53159817 - 53159778
Alignment:
| Q |
52 |
ctacaacgatccataaccggtaacaattcaatatggtgca |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53159817 |
ctacaacgatccataaccggtaacaattcaatatggtgca |
53159778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 25 - 91
Target Start/End: Original strand, 39905597 - 39905663
Alignment:
| Q |
25 |
tttgtcactaggacttcattccaattgctacaacgatccataaccggtaacaattcaatatggtgca |
91 |
Q |
| |
|
||||||||||||||||||| ||| |||||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
39905597 |
tttgtcactaggacttcataccagttgctaaaaagatccataaccggtaacaattaaatatggtgca |
39905663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 215 - 251
Target Start/End: Original strand, 39905787 - 39905823
Alignment:
| Q |
215 |
ataactagagtgaccgtggcagttaaggtgtcgccgg |
251 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
39905787 |
ataactggagtgaccgtgacagttaaggtgtcgccgg |
39905823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University