View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18886_low_14 (Length: 280)
Name: NF18886_low_14
Description: NF18886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18886_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 274
Target Start/End: Complemental strand, 48186831 - 48186572
Alignment:
| Q |
19 |
atataatgtacaaatcatccctaagccttaaaaaattgcagcatttctgcaatgctcgacttttctgtctataataatattatatttatccaaatataag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48186831 |
atataatgtacaaatcatccctaagccttaaaaaattgcagcatttctgcaatgctcgacttttctgtctataataatattatatttatccaaatataag |
48186732 |
T |
 |
| Q |
119 |
gaacttttgtctgnnnnnnnnnc----tacctagacccaattaattgtgtatgggagactttttcctagctggtgaataatccatctcagttatgtctac |
214 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48186731 |
gaacttttgtctgtttttttttccttctacctagacccaattaattgtgtatgggagactttttcctagctggtgaataatccatctcagttatgtctac |
48186632 |
T |
 |
| Q |
215 |
aaggtcctcagggagataattagaagtactcaatgattttacttttatttcctttgcttc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48186631 |
aaggtcctcagggagataattagaagtactcaatgattttacttttatttcctttgcttc |
48186572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University