View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18886_low_28 (Length: 216)
Name: NF18886_low_28
Description: NF18886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18886_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 195
Target Start/End: Complemental strand, 39765008 - 39764825
Alignment:
| Q |
12 |
ggagtagcaaaggataaatacctaagttgcctaggaaccaattggaccacagaaaaaccagcacccccgaagcctgacagtgaaggcatccaattcttca |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39765008 |
ggagtaacaaaggataaatacctaagttgcctaggaaccaattggaccacagaaaaaccagcacccccgaagcctgacagtgaaggcatccaattcttca |
39764909 |
T |
 |
| Q |
112 |
atggtacacttgatgtcttgttatcgtcatcgtcattattcacatgagtttcactacttgaaagaagtatggatttagcagtat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39764908 |
atggtacacttgatgtcttgttatcgtcatcgtcattattcacatgagtttcactacttgaaagaagtatggatttagcagtat |
39764825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 56 - 188
Target Start/End: Complemental strand, 39757889 - 39757760
Alignment:
| Q |
56 |
gaccacagaaaaaccagcacccccgaagcctgacagtgaaggcatccaattcttcaatggtacacttgatgtcttgttatcgtcatcgtcattattcaca |
155 |
Q |
| |
|
||||| || ||||||| || ||| ||||||||| ||||||||||||||| ||||||| |||||||||||| ||||||| || || |||||| |||| |
|
|
| T |
39757889 |
gaccaaagcaaaaccaacatccctgaagcctgatagtgaaggcatccaactcttcaacggtacacttgatatcttgtt---gttattgtcatttttcatt |
39757793 |
T |
 |
| Q |
156 |
tgagtttcactacttgaaagaagtatggattta |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39757792 |
tgagtttcactacttgaaagaagtatggattta |
39757760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University