View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18887_high_15 (Length: 372)
Name: NF18887_high_15
Description: NF18887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18887_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 10 - 358
Target Start/End: Original strand, 28249445 - 28249791
Alignment:
| Q |
10 |
acatcatcatcttcgtcaactccgatcgtaactcctcattctctctcaccaacgacacatccgtcgctaaacgattcctctccgtcgcagctccatcgca |
109 |
Q |
| |
|
||||| ||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
28249445 |
acatcttcatcttcgtcaattctgatcgtaactcctcattctctctcaccaacgatacatccgtcgctaaccgattcctctccgtcgcagctccgtcgca |
28249544 |
T |
|
| Q |
110 |
ttcgccgtcgtctgatccactcctcaacttcaactgatcgtagtatagcgcgtgtaaaacaatctgtaccggtaaccgtttgttctgtgacgcgtgcaca |
209 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28249545 |
ttcaccgtcgtctgatccactcctcaacttcaactgatcgtagtatagcgcgtgtaaaacaatctgtaccggtaaccgtttgttctgtgacgcgtgcaca |
28249644 |
T |
|
| Q |
210 |
cgcgcttcgtaggatagcttcaatggatccattacgctgcatactttctctctttcgatttcatctagctttggatgaacctgnnnnnnnntaatataca |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28249645 |
cgcgcttcgtaggatagcttcaatggatccattacgctgcatactttctctctttcgatttcatctagctttggatgaacctgaaaaaaa--aatataca |
28249742 |
T |
|
| Q |
310 |
aactcgttaaaaggtgtcgtttttcatcaactaaattcatattcaaatt |
358 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28249743 |
aactcgttaaacggtgtcgtttttcatcaactaaattcaaattcaaatt |
28249791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University