View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18887_high_28 (Length: 249)
Name: NF18887_high_28
Description: NF18887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18887_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 42499363 - 42499132
Alignment:
| Q |
1 |
attttgcagattcttttgaaggtgttccatcatatcctttatacacccgtcttgcttcagctctgttgaggtgtatccattctcaattgttttgtaatac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
42499363 |
attttgcagattcttttgaaggtgttccatcatatcctttatacagccgtcttgcttcagctctgttgaggtgtattgattctcaagtgttttgtaatac |
42499264 |
T |
 |
| Q |
101 |
aagctctttatgcaattacatgatgatcaatgaatctcaaaattcttccatgcaacaaaaacacaatgaatggcataagttgattgtggagaagggatct |
200 |
Q |
| |
|
|| ||||||| ||||||||| |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42499263 |
aatctctttag------acatgatgaacaatgaatttgaaaattcttccatgcaacaaaaacacaatgaatggcataagttgattgtggagaagggatct |
42499170 |
T |
 |
| Q |
201 |
gaaatactgaatgtaaactgttatgctaattgcttcat |
238 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
42499169 |
gaaatagtgaatgtaaactgttatgcaaattgcttcat |
42499132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University