View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18887_high_29 (Length: 249)
Name: NF18887_high_29
Description: NF18887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18887_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 53307171 - 53307394
Alignment:
| Q |
18 |
caaattaaacgcattactttgggtctctaaatgttgcaaacctttcggcgactgcagcgcggtcgtctccgttgctcatgcacactgcaattttcaagat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53307171 |
caaattaaacgcattactttgggtctctaaatgttgcaaacctttcggcgactgcagcgcggtcgtctccgttgctcatgcacactgcaattttcaagat |
53307270 |
T |
 |
| Q |
118 |
tgttttaagctttctttagtctaatctcgtgtgcaaagcttataagcttgctttttcttgacgcattcaattaaaattgtatggccatcccaatgaaaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53307271 |
tgttttaagctttctttagtctaatctcgtgtgcaaagcttataggcttgctttttcttgacgcattcaattaaaattgtgtggccatcccaatgaaaat |
53307370 |
T |
 |
| Q |
218 |
tgtagtattattgtaattcatctc |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
53307371 |
tgtagtattattgtaattcatctc |
53307394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University