View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18887_high_30 (Length: 238)
Name: NF18887_high_30
Description: NF18887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18887_high_30 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 25 - 238
Target Start/End: Original strand, 23844959 - 23845176
Alignment:
| Q |
25 |
ataccacaaggtgatcgggtatgccaatggcgaggaggaaat----ggcagtaggcatactataagactttccaataaacataggggctcaatttggaca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23844959 |
ataccacaaggtgatcgggtatgccaatggcgaggaggaaataaatggcagtagacatactatacgactttccaataaacataggggctcaatttggaca |
23845058 |
T |
|
| Q |
121 |
tcgtaatagttgacaccaatgacaggtacaattttccaattatccttggaagatcgttctttgctcagactagccttattttggatggaggacaggggcg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||| ||||||||| |
|
|
| T |
23845059 |
tcgtaatagttgacaccaatgacaggtacaattttccaattatccttggcagatcgttctttgctcagactagtcttattttcgatggagaacaggggcg |
23845158 |
T |
|
| Q |
221 |
cactatcatcagaaccca |
238 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
23845159 |
cactatcatcagaaccca |
23845176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 205
Target Start/End: Complemental strand, 28858407 - 28858353
Alignment:
| Q |
151 |
attttccaattatccttggaagatcgttctttgctcagactagccttattttgga |
205 |
Q |
| |
|
|||| ||||||||||| || |||||||||||||||||| || | ||||||||||| |
|
|
| T |
28858407 |
atttcccaattatcctagggagatcgttctttgctcaggctggtcttattttgga |
28858353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University