View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18887_high_34 (Length: 208)

Name: NF18887_high_34
Description: NF18887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18887_high_34
NF18887_high_34
[»] chr5 (1 HSPs)
chr5 (20-159)||(42450703-42450838)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 159
Target Start/End: Original strand, 42450703 - 42450838
Alignment:
20 agcacaagtagttgatgcacaatatgtgtgaaagttgtaaaccctattatatccggttcaattgggttgtttacctggattaaattacgtcgtaatannn 119  Q
    ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||||||  ||||||||||||||||||||||        
42450703 agcacaagtagttgatgcacaatatgtg--aaagttgtaaaccctattatatccggttcgattgggttgtttctctggattaaattacgtcgtaat--gt 42450798  T
120 nnnnatcacaaatgatgtttgtcataatgctttattatat 159  Q
        ||||||||||||||||||||||||||||||||||||    
42450799 ttttatcacaaatgatgtttgtcataatgctttattatat 42450838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University