View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18887_low_11 (Length: 414)
Name: NF18887_low_11
Description: NF18887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18887_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 13 - 220
Target Start/End: Original strand, 10648192 - 10648399
Alignment:
| Q |
13 |
attctccaatatatgatgcatgttacacacaataaatatgatcaaacgattcacccttactcctcaacacctaagtgagtattatagtcacctcttgcaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10648192 |
attctccaatatatgatgcatgttacacacaataaatatgatcaaacgactcacccttactcctcaatacctaagtgagtattatagtcacctcttgcaa |
10648291 |
T |
|
| Q |
113 |
gctaagtacgttcaaataggacattaactaagcactgttttcgtccctcgcaggcgaagcgtctcttctcaataatctccataatagaatttatataatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
10648292 |
gctaagtacgttcaaataggacattaactacgcactattttcgtccctcgcaggctaagcgtctcttctcaataatgtccataacagaatttatataatt |
10648391 |
T |
|
| Q |
213 |
caaactta |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
10648392 |
caaactta |
10648399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University