View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18887_low_19 (Length: 347)
Name: NF18887_low_19
Description: NF18887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18887_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 244
Target Start/End: Original strand, 12032812 - 12033037
Alignment:
| Q |
16 |
ttctatgcacaacataaactaaacatgtacacctctctctacttggattcaaacattgtaagaatcgattttaaatatttataaatgttagtttttaata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12032812 |
ttctatgcacaacataaactaaacatgtacacctctctctacttggattcaaacattgtaagaatcgattttaaatatttataaatgttagttgttaata |
12032911 |
T |
 |
| Q |
116 |
tgttattacatcgactagagtttaaatcttaaacttttttgaagtctcttgaaatgtctcatctcaaatacttgattcaactattttagctacgttttga |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12032912 |
tgtta---catcgactagagtttaaatcttaaacatttttgaagtctcttgaaatgtctcatctcaaatacttgattcaactattttagctacgttttga |
12033008 |
T |
 |
| Q |
216 |
atattactgatcgattatctctatgggtt |
244 |
Q |
| |
|
| |||||||||||||| |||||||||||| |
|
|
| T |
12033009 |
agattactgatcgattctctctatgggtt |
12033037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University