View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18887_low_25 (Length: 274)
Name: NF18887_low_25
Description: NF18887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18887_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 23 - 245
Target Start/End: Complemental strand, 22197465 - 22197243
Alignment:
| Q |
23 |
tcagatgagtcacttcaactggttcaacctattgtataactgagattaaatcaaccagcggatttaataccggcgaattggccgattcccatttcaatct |
122 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22197465 |
tcagacgagtcacttcaactggttcaacctattgtataactgagattaaatcaaccagcggatttaataccggcgaattggccgattcccatttcaatct |
22197366 |
T |
 |
| Q |
123 |
gttgaatcggacactttgatctggttttaaaacattgcttcaaattaacaattctatttttgtaagtgaaaaactaacgttaaatatctttgactagagc |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
22197365 |
gttgaatcggacacttcgatctggttttaaaacattgcttcaaattaacaattctatttttgtaagtgaaaaactaatgttaaatatcttggactagagc |
22197266 |
T |
 |
| Q |
223 |
gtcattttctcatcctaaatttc |
245 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
22197265 |
gtcattttctcatcctaaatttc |
22197243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University