View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18887_low_30 (Length: 258)

Name: NF18887_low_30
Description: NF18887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18887_low_30
NF18887_low_30
[»] chr4 (2 HSPs)
chr4 (19-143)||(43614911-43615035)
chr4 (185-241)||(43615077-43615133)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 19 - 143
Target Start/End: Original strand, 43614911 - 43615035
Alignment:
19 ctttagctagtttttactcatctctgagttgaactcaaatcactcgaactaattttttctaaaagttggagggttaaaaataaaagaactatcataaata 118  Q
    ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43614911 ctttagctagtttttactcatctttgagttgaactcaaatcacttgaactaattttttctaaaagttggagggttaaaaataaaagaactatcataaata 43615010  T
119 aaagaagtagtagtactagagcaac 143  Q
    ||||||| |||||||||||||||||    
43615011 aaagaagcagtagtactagagcaac 43615035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 43615077 - 43615133
Alignment:
185 agtttggaccagagccagcatgtaacatggagtatctgttgaacatcgcactgtaaa 241  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||    
43615077 agtttggaccagagctagcatgtaacatggtgtatctgttgaacatcgcactgtaaa 43615133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University