View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18887_low_39 (Length: 208)
Name: NF18887_low_39
Description: NF18887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18887_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 159
Target Start/End: Original strand, 42450703 - 42450838
Alignment:
| Q |
20 |
agcacaagtagttgatgcacaatatgtgtgaaagttgtaaaccctattatatccggttcaattgggttgtttacctggattaaattacgtcgtaatannn |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
42450703 |
agcacaagtagttgatgcacaatatgtg--aaagttgtaaaccctattatatccggttcgattgggttgtttctctggattaaattacgtcgtaat--gt |
42450798 |
T |
|
| Q |
120 |
nnnnatcacaaatgatgtttgtcataatgctttattatat |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42450799 |
ttttatcacaaatgatgtttgtcataatgctttattatat |
42450838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University