View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18888_low_13 (Length: 257)
Name: NF18888_low_13
Description: NF18888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18888_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 33121478 - 33121706
Alignment:
| Q |
18 |
aaggatcattttcaataatgtgacagcttatgattgattgattgtgtaaaaaatattgtatcaaaatgaaactcgtcgttctaacctgatcaatgatttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33121478 |
aaggatcattttcaataatgtgacagcttatgattgattgattgtgtaaaaaatattgtatcaaaatgaaactcgtcgttctaacctgatcaatgatttc |
33121577 |
T |
|
| Q |
118 |
atattttgaaggtggtgtgttataaaaagcctttgttctttctttaggaggtgcagcaaaaactctactcatcttattctcgaggagagtaataggaaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33121578 |
atattttgaaggtggtgtgttataaaaagcctttgttctttctttaggaggtgcagcaaaaactctactcatcttattctcgaggagagtaataggaaca |
33121677 |
T |
|
| Q |
218 |
ccttgttgagtccatgaacctggcttcat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33121678 |
ccttgttgagtccatgaacctggcttcat |
33121706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University