View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18888_low_8 (Length: 341)
Name: NF18888_low_8
Description: NF18888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18888_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 44 - 329
Target Start/End: Original strand, 27260676 - 27260962
Alignment:
| Q |
44 |
tagagtttcagacaagcatgagttcaaaggaaaactattatgttcaaagttagttagaaatatatcaagcaacatattttattttttggcagacaaagca |
143 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27260676 |
tagagtttcagagaagcatgagttcaaaggaaaactattatgttcaaagttagttagaaacatatcaagcaacatattttattttttggcagacaaagca |
27260775 |
T |
 |
| Q |
144 |
gattgggcagtggctggctgtgggacatataaatccaaatgtggctgcttaatttggatcacatatggattgtcgtatacgtgtataatttccaagaaga |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
27260776 |
gattgggcagtggctggctgtgggacatataaatccaaatgtggctgcttaatttggatcacatatggattgtcgtatacctgtataattttcaagaaga |
27260875 |
T |
 |
| Q |
244 |
tcaaactcaacaccttca-nnnnnnnngaaagaactcaatatcttcatttgtttggatgaaactcacactcactagaagaggttgca |
329 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27260876 |
tcaaactcaataccttcatttttttttgaaagaattcagtatcttcatttgtttggatgaaactcacactcactagaagaggttgca |
27260962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 180 - 243
Target Start/End: Complemental strand, 21196615 - 21196552
Alignment:
| Q |
180 |
aaatgtggctgcttaatttggatcacatatggattgtcgtatacgtgtataatttccaagaaga |
243 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| ||| | |||||| |||||||||||||| |
|
|
| T |
21196615 |
aaatgtggttgcttaattttcatcacatatggattaccgtgtgcgtgtacaatttccaagaaga |
21196552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University