View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18889_high_10 (Length: 360)
Name: NF18889_high_10
Description: NF18889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18889_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 84 - 344
Target Start/End: Original strand, 32891942 - 32892202
Alignment:
| Q |
84 |
ctagctaagatacaaaattaattnnnnnnncacctaccatgcatatatatggaagaattactagctagttgtgaagaggatttggaccagtgtgaattaa |
183 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32891942 |
ctagctaagatacaaaattaattaaaaaaacacctaccatgcatatatatggaagaattactagctagttgtgaagaggatttggaccagtgtgaattaa |
32892041 |
T |
 |
| Q |
184 |
tctcttgtcatcaccataaagtggatcaccaacatttgtagtggttctagcttgatcatgatgatgagtagttcttgttctttgttttgaaggtgcatga |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32892042 |
tctcttgtcatcaccataaagtggatcaccaacatttgtagtggttctagcttgatcatgatgatgagtagttcttgttctttgttttgaaggtgcatga |
32892141 |
T |
 |
| Q |
284 |
gacagtaatgctttgttgaaagtacgttgtctgagtaaccgaatatttgaatggtggttgt |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32892142 |
gacagtaatgctttgttgaaagtacgttgtctgagtaaccgaatatttgaatggttgttgt |
32892202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University