View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18889_high_23 (Length: 214)
Name: NF18889_high_23
Description: NF18889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18889_high_23 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 3 - 214
Target Start/End: Complemental strand, 2272261 - 2272050
Alignment:
| Q |
3 |
ctatttgcttggcgactactttggaacagatcaactaccaaaaataatttatacaggcgaatcattattcatccggatgctcaattttgtgttgtgggtt |
102 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2272261 |
ctatttgtttggcgactactttggaacagatcaactaccaaaaataatttatacaggcgaatcattattcatccggatgctcaattttgtgttgcgggtt |
2272162 |
T |
 |
| Q |
103 |
gccaccaacatgagcctgcagagtatctatttcttcagtgttctttgttaggttccttatggagcggcatttttgtgtggatcgattttcctacagtttc |
202 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2272161 |
gccaccaacatgagtctgcagagtatctatttcttcagtgttctttgttaggttccttatggagcggcattttcttgtggatcgattttcctacagtttc |
2272062 |
T |
 |
| Q |
203 |
tcctgagaattt |
214 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2272061 |
tcctgagaattt |
2272050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University