View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18889_low_19 (Length: 238)
Name: NF18889_low_19
Description: NF18889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18889_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 19507087 - 19506874
Alignment:
| Q |
17 |
acttcgtactttataatatataacagnnnnnnntagtttaattttcttcacgaaaccaaacaaagttaannnnnnncgtaggtgtcattcagatggtaaa |
116 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
19507087 |
acttcgtactttataatatataatggaaaaaaatagtttaattttcttcaccaaaccaaacaaagttattttttttcgtaggtatcattcagatggtaaa |
19506988 |
T |
 |
| Q |
117 |
aacgcaaaaaatacatttaatatgtatcttaaggtgtaagttcgaaccctaccatttttatatacttnnnnnnnttgtgcattttgcgggtagacactaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
19506987 |
aacgcaaaaaatacatttaatatgtatcttaaggtgtaagttcgaaccctaccacttttataaacttaaaaaaattgtgcattttgcgggtagacactaa |
19506888 |
T |
 |
| Q |
217 |
gaaaaaataattaa |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19506887 |
gaaaaaataattaa |
19506874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University