View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18889_low_23 (Length: 231)
Name: NF18889_low_23
Description: NF18889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18889_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 51 - 213
Target Start/End: Original strand, 8172895 - 8173057
Alignment:
| Q |
51 |
ttctcattaatatttagtataaaacagaatgacaattacactgtgatataaaggattggtagctcacaaccttctaaccaacaagtgtaaaataccggta |
150 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8172895 |
ttctcattaatatttattataaaacagaatgacaattacactgtgatataaaggattggtagctcacaaccttctaaccaacaagtgtaaaataccggta |
8172994 |
T |
|
| Q |
151 |
aaatagaaataacgaacatagcagagaataaaatgcagctgcaattgctgccagccagcttct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8172995 |
aaatagaaataacgaacatagcagagaataaaatgcagctgcaattgctgtcagccagcttct |
8173057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University