View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18890_high_22 (Length: 259)
Name: NF18890_high_22
Description: NF18890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18890_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 42716108 - 42715883
Alignment:
| Q |
13 |
tgaagcgagaagaagatcgaagaaagattgaaaattagggtttcccaaactcctcggatctgcgccgtggagttgaagggaagagtgagagagagattta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42716108 |
tgaagcgagaagaagatcgaagaaagattgaaaattagggtttcccaaactcctcggatctgcgccgtggagttgaagggaagagtgagagagagattta |
42716009 |
T |
|
| Q |
113 |
ggttatataggcgtgctttttatttgtagcgtatgta-ttttactacgactaggattaggatttgctgattacacccccaaaaaacacaaaatttagttt |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42716008 |
ggttatatatgcgtgctttttatttgtagcgtatgtatttttactactactaggattaggatttgctgattacacccccaaaaaacacaaaatttagttt |
42715909 |
T |
|
| Q |
212 |
tgatctctaaaataccaatagtttca |
237 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
42715908 |
taatctctaaaataccaatagtttca |
42715883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University